Abstract
Cancer genotyping has identified a large number of putative tumor suppressor genes. Carcinogenesis is a multistep process, but the importance and specific roles of many of these genes during tumor initiation, growth, and progression remain unknown. Here we use a multiplexed mouse model of oncogenic KRAS–driven lung cancer to quantify the impact of 48 known and putative tumor suppressor genes on diverse aspects of carcinogenesis at an unprecedented scale and resolution. We uncover many previously understudied functional tumor suppressors that constrain cancer in vivo. Inactivation of some genes substantially increased growth, whereas the inactivation of others increases tumor initiation and/or the emergence of exceptionally large tumors. These functional in vivo analyses revealed an unexpectedly complex landscape of tumor suppression that has implications for understanding cancer evolution, interpreting clinical cancer genome sequencing data, and directing approaches to limit tumor initiation and progression.
Our high-throughput and high-resolution analysis of tumor suppression uncovered novel genetic determinants of oncogenic KRAS–driven lung cancer initiation, overall growth, and exceptional growth. This taxonomy is consistent with changing constraints during the life history of cancer and highlights the value of quantitative in vivo genetic analyses in autochthonous cancer models.
This article is highlighted in the In This Issue feature, p. 1601
Introduction
Cancer initiation and development is a multistep process driven in large part by cancer cell–intrinsic alterations (1). Over the past several decades, cancer genome sequencing has contributed to our understanding of the genetic drivers of cancer and identified a large number of putative tumor suppressor genes (2–8). However, genome–sequencing data are insufficient to determine the importance of these genes during various stages of carcinogenesis (9). The nature and frequency of genomic alterations also provide limited insight into the modes of action of putative tumor suppressor genes, underscoring the importance of functional genomics in elucidating gene function (10, 11).
Tumor suppressors regulate many different pathways and cellular processes. Assessing their impact on tumor initiation and each step of cancer development not only distinguishes driver from passenger genes but also highlights different pathways and processes that constrain carcinogenesis across the course of the disease (12, 13). Thus, in vivo functional genomic approaches are critical for understanding cancer evolution (14–16), interpreting clinical cancer genome sequencing data (17, 18), and directing precision medicine approaches (19, 20).
In vivo cancer models in which tumor initiation and growth occur entirely within the autochthonous environment are uniquely tractable systems to uncover gene function (21). The integration of CRISPR/Cas9 somatic genome editing into genetically engineered mouse models of human cancer has facilitated the rapid analysis of gene function in vivo (22–25). Recently, the combination of somatic CRISPR-based genome editing with tumor barcoding and high-throughput barcode sequencing (Tuba-seq) has greatly increased the scale and precision of these in vivo approaches (26, 27). These types of approaches can quantify the impact of many engineered genomic alterations on cancer growth in vivo in a multiplexed manner (12, 26–28).
Here we integrate multiple critical advances in our Tuba-seq pipeline and quantify the roles of a broad range of diverse putative tumor suppressors across multiple facets of carcinogenesis. By uncovering the extent to which different tumor suppressors govern tumor initiation, growth, and acquisition of altered phenotypes across time, we uncover an unexpectedly complex taxonomy of tumor suppression across the life history of oncogenic KRAS–driven lung cancer.
Results
Prioritization of Candidate Tumor Suppressor Genes
To characterize the functional landscape of tumor suppression, we selected 48 known and putative tumor suppressor genes to investigate using Tuba-seq in a model of oncogenic KRAS–driven lung cancer (Fig. 1A; Methods). These genes were chosen based on multiple criteria, including their mutational frequency in lung adenocarcinoma from The Cancer Genome Atlas (TCGA), GENIE, and TRACERx data sets; their mutational frequency in pan-cancer genomic data; and the consistency of their mutational profiles with tumor suppressor activity (Fig. 1A and B; Supplementary Fig. S1A–S1E; Supplementary Table S1; refs. 2, 4–7). We also considered their putative tumor-suppressive function in other cancer types as well as their molecular functions (Supplementary Fig. S2A and S2B; refs. 8, 29, 30). Our candidate genes vary greatly in their mutation frequency and co-occurrence with oncogenic KRAS alterations (Supplementary Fig. S1C–S1E). Importantly, these genes include well-studied tumor suppressors as well as genes for which there is very limited evidence supporting a role in constraining any aspect of carcinogenesis (Supplementary Fig. S3A and S3B).
An in vivo screen for tumor suppressor genes in autochthonous oncogenic KRAS–driven lung tumors. A, Candidate tumor suppressor genes were chosen based on multiple criteria, including their frequency and known/predicted biological functions. The plot shows the mutation frequencies of these 48 genes across pan-cancer and in lung adenocarcinoma (data from TCGA). Color denotes lung adenocarcinoma driver consensus score derived from multiple prediction tools. Several genes that are mutated at high frequency in lung adenocarcinoma or pan-cancer are labeled. B, Features of the mutations in each gene are consistent with tumor suppressor function. Green's contagion is a measure of mutational hotspots, which characterize oncogenes. Larger values indicate that mutations are enriched in particular residues of the protein. This measure of overdispersion is normalized to not scale with sample size and to be zero when mutations are randomly scattered across the transcript. Average fraction of protein lost by mutation combines the nonsense/frameshift mutation rate and location of the mutations in each gene [(percent of protein transcript altering mutations that are nonsense or frameshift) * (Average fraction of protein lost by nonsense or frameshift mutations)]. C, Schematic of tumor initiation with our pool of 102 barcoded Lenti-sgRNA/Cre vectors (Lenti-sgTS102/Cre). Each gene is targeted with two sgRNAs, except Trp53, which is targeted by three sgRNAs. Five inert sgRNAs are either nontargeting (NT) or have an active targeting but inert sgRNAs (which target NeoR in the R26LSL-Tomato allele). Barcoded lentiviral vectors contain an sgRNA, Cre, and a two-component barcode that includes an sgRNA identifier (sgID) and random barcode (BC). This allows inactivation of multiple target genes in parallel followed by quantification of the number of neoplastic cells by high-throughput sgID-BC sequencing. Mouse genotype, mouse number, and titer of lentiviral vectors are indicated. Tuba-seq was performed on each tumor-bearing lung 15 weeks after initiation, followed by analyses to quantify the indicated metrics. ifu, infectious units. D, Fluorescence images of lungs from representative mice at 15 weeks after tumor initiation. Lung lobes are outlined with a dashed white line. Scale bars, 2 mm. E, Pearson correlation coefficient (r) and P value (two-tailed) suggest strong correlation between neoplastic cell number (an indicator of tumor burden) and lung weight. Each dot represents a mouse. When taking into account that tumors were initiated in KT;H11LSL-Cas9 mice with 3-fold less Lenti-sgTS102/Cre vectors, the total neoplastic cell number is ∼10-fold greater in KT;H11LSL-Cas9 mice than in KT mice. F, Volcano plot of the impact of inactivating each putative tumor suppressor gene on relative tumor burden. Each dot represents an sgRNA. Inert sgRNAs are in gray. Tumor suppressor genes are colored pink when both sgRNAs induce a moderate but significant increase and green when one sgRNA induces a >4-fold increase and the other induces a moderate but significant increase. Data are aggregated from 47 KT;H11LSL-Cas9 and 12 KT mice.
An in vivo screen for tumor suppressor genes in autochthonous oncogenic KRAS–driven lung tumors. A, Candidate tumor suppressor genes were chosen based on multiple criteria, including their frequency and known/predicted biological functions. The plot shows the mutation frequencies of these 48 genes across pan-cancer and in lung adenocarcinoma (data from TCGA). Color denotes lung adenocarcinoma driver consensus score derived from multiple prediction tools. Several genes that are mutated at high frequency in lung adenocarcinoma or pan-cancer are labeled. B, Features of the mutations in each gene are consistent with tumor suppressor function. Green's contagion is a measure of mutational hotspots, which characterize oncogenes. Larger values indicate that mutations are enriched in particular residues of the protein. This measure of overdispersion is normalized to not scale with sample size and to be zero when mutations are randomly scattered across the transcript. Average fraction of protein lost by mutation combines the nonsense/frameshift mutation rate and location of the mutations in each gene [(percent of protein transcript altering mutations that are nonsense or frameshift) * (Average fraction of protein lost by nonsense or frameshift mutations)]. C, Schematic of tumor initiation with our pool of 102 barcoded Lenti-sgRNA/Cre vectors (Lenti-sgTS102/Cre). Each gene is targeted with two sgRNAs, except Trp53, which is targeted by three sgRNAs. Five inert sgRNAs are either nontargeting (NT) or have an active targeting but inert sgRNAs (which target NeoR in the R26LSL-Tomato allele). Barcoded lentiviral vectors contain an sgRNA, Cre, and a two-component barcode that includes an sgRNA identifier (sgID) and random barcode (BC). This allows inactivation of multiple target genes in parallel followed by quantification of the number of neoplastic cells by high-throughput sgID-BC sequencing. Mouse genotype, mouse number, and titer of lentiviral vectors are indicated. Tuba-seq was performed on each tumor-bearing lung 15 weeks after initiation, followed by analyses to quantify the indicated metrics. ifu, infectious units. D, Fluorescence images of lungs from representative mice at 15 weeks after tumor initiation. Lung lobes are outlined with a dashed white line. Scale bars, 2 mm. E, Pearson correlation coefficient (r) and P value (two-tailed) suggest strong correlation between neoplastic cell number (an indicator of tumor burden) and lung weight. Each dot represents a mouse. When taking into account that tumors were initiated in KT;H11LSL-Cas9 mice with 3-fold less Lenti-sgTS102/Cre vectors, the total neoplastic cell number is ∼10-fold greater in KT;H11LSL-Cas9 mice than in KT mice. F, Volcano plot of the impact of inactivating each putative tumor suppressor gene on relative tumor burden. Each dot represents an sgRNA. Inert sgRNAs are in gray. Tumor suppressor genes are colored pink when both sgRNAs induce a moderate but significant increase and green when one sgRNA induces a >4-fold increase and the other induces a moderate but significant increase. Data are aggregated from 47 KT;H11LSL-Cas9 and 12 KT mice.
Quantitative Analysis Uncovers Diverse Tumor Suppressors with Distinct Abilities to Constrain Tumor Growth In Vivo
To determine the impact of inactivating each candidate tumor suppressor gene on carcinogenesis in vivo, we used Tuba-seq to quantify the tumor size profiles after inactivation of each gene (Supplementary Fig. S4A). We generated at least two Lenti-single-guide RNA (sgRNA)/Cre vectors with distinct sgRNAs targeting each gene and five Lenti-sgInert/Cre negative control vectors (102 total vectors; Fig. 1C; Supplementary Table S2). Each vector contains a two-component sgID-BC, where the sgID uniquely identifies the sgRNA and the diverse random 20-nucleotide barcode (BC) uniquely labels each clonal tumor. We generated each lentiviral vector separately and pooled them to generate a highly multiplexed vector pool (Lenti-sgTS102/Cre; Fig. 1C; Methods). We initiated lung tumors with this pool inKrasLSL-G12D/+;R26LSL-Tom;H11LSL-Cas9 (KT;H11LSL-Cas9) mice and Cas9-negative control KrasLSL-G12D/+;R26LSL-Tom (KT) mice. These Cas9-negative mice are necessary to confirm that all vectors have little impact on tumor growth in the absence of Cas9 and to calculate genotype-specific effects on tumor number (see below). Fifteen weeks after tumor initiation, KT;H11LSL-Cas9 mice had visibly larger tumors than KT mice (Fig. 1D). We extracted DNA from bulk tumor–bearing lungs and used Tuba-seq to quantify overall tumor burden and the sizes of each tumor, of each genotype, in each mouse.
KT;H11LSL-Cas9 mice had ∼10-fold higher total neoplastic cell number and proportionally increased lung weight (Fig. 1E). Initial analysis of the impact of each sgRNA on tumor burden (a metric of the relative number of neoplastic cells in all tumors of the same sgRNA) highlighted many genes as functional tumor suppressors. Even this relatively crude metric, which does not incorporate the per-tumor resolution of Tuba-seq, uncovered genes in which both sgRNAs increased tumor burden (Fig. 1F). To investigate which aspects of carcinogenesis are regulated by putative tumor suppressor genes, we calculated multiple summary statistics. We applied our experimental design to identify tumor suppressor genes that normally limit overall tumor growth, tumor initiation, and the emergence of exceptionally large tumors (Fig. 1C; Supplementary Fig. S4B and S4C; Methods).
Many Diverse Tumor Suppressor Genes Increased Overall Tumor Growth
The ability of Tuba-seq to quantify the number of neoplastic cells in thousands of tumors of each genotype allowed us to precisely assess their impact on tumor growth with greater precision than previous approaches. We calculated two metrics of tumor growth from the distribution of tumor sizes to uncover the effect of inactivating each tumor suppressor on overall tumor growth (tumor sizes at defined percentiles within the tumor size distribution and log-normal mean; Methods; Supplementary Fig. S4B). As expected, tumors initiated with each Lenti-sgRNA/Cre vector in control Cas9-negative KT mice had very similar tumor size profiles, suggesting that our pipeline is free from bias and false-positive signals (Supplementary Fig. S5A). Consistent with previous Cre/lox and CRISPR/Cas9-based mouse models (22, 26, 31–34), inactivation of Stk11/Lkb1, Pten, Setd2, and Nf1 in tumors in KT;H11LSL-Cas9 mice greatly increased tumor growth (Fig. 2A–C; Supplementary Fig. S5B). Importantly, inactivation of STAG2, a cohesin complex component, increased tumor growth to a comparable extent as inactivation of those well-established tumor suppressors (Fig. 2A–C; Supplementary Fig. S5B).
In vivo lung tumor growth is suppressed by diverse tumor suppressor genes. A, The 95th percentile tumor size (normalized to tumors with sgInerts) for each putative tumor suppressor targeting sgRNA in KT;H11LSL-Cas9 mice. Error bars indicate 95% confidence intervals. The 95% confidence intervals and P values were calculated by bootstrapping. sgRNAs that significantly increase or decrease tumor size are colored as indicated. sgInerts are in gray and the dotted line indicates no effect. Genes are ordered based on the average of the 95th percentile tumor sizes from all sgRNAs targeting that gene, with individual sgRNAs targeting each gene ranked by effect for clarity. Pearson correlation coefficient (r) and P value (two-tailed) suggest that sgRNAs targeting the same putative tumor suppressor elicit consistent and similar changes in size at the 95th percentile. B, Tumor sizes at the indicated percentiles for the top 17 tumor suppressor genes (relative to the average of sgInert-containing tumors) in KT;H11LSL-Cas9 mice. Error bars indicate 95% confidence intervals. Dotted line indicates no effect. Percentiles that are significantly different from the average of sgInerts are in color. Data for all genes are shown in Supplementary Fig. S5B. Pearson correlation coefficient (r) and P value (two-tailed) for all sgRNA across all indicated percentiles are shown. C, The log-normal mean tumor size (normalized to tumors with sgInerts) for each putative tumor suppressor targeting sgRNA in KT;H11LSL-Cas9 mice. Error bars indicate 95% confidence intervals. The 95% confidence intervals and P values were calculated by bootstrapping. sgRNAs that significantly increase or decrease tumor size are colored as indicated. sgInerts are in gray and the dotted line indicates no effect. Genes and sgRNAs are ordered as in A. The high Pearson correlation coefficient suggests that sgRNAs targeting the same putative tumor suppressor elicit consistent and similar changes in log-normal mean tumor size. All plots represent aggregated data from 47 KT;H11LSL-Cas9 mice.
In vivo lung tumor growth is suppressed by diverse tumor suppressor genes. A, The 95th percentile tumor size (normalized to tumors with sgInerts) for each putative tumor suppressor targeting sgRNA in KT;H11LSL-Cas9 mice. Error bars indicate 95% confidence intervals. The 95% confidence intervals and P values were calculated by bootstrapping. sgRNAs that significantly increase or decrease tumor size are colored as indicated. sgInerts are in gray and the dotted line indicates no effect. Genes are ordered based on the average of the 95th percentile tumor sizes from all sgRNAs targeting that gene, with individual sgRNAs targeting each gene ranked by effect for clarity. Pearson correlation coefficient (r) and P value (two-tailed) suggest that sgRNAs targeting the same putative tumor suppressor elicit consistent and similar changes in size at the 95th percentile. B, Tumor sizes at the indicated percentiles for the top 17 tumor suppressor genes (relative to the average of sgInert-containing tumors) in KT;H11LSL-Cas9 mice. Error bars indicate 95% confidence intervals. Dotted line indicates no effect. Percentiles that are significantly different from the average of sgInerts are in color. Data for all genes are shown in Supplementary Fig. S5B. Pearson correlation coefficient (r) and P value (two-tailed) for all sgRNA across all indicated percentiles are shown. C, The log-normal mean tumor size (normalized to tumors with sgInerts) for each putative tumor suppressor targeting sgRNA in KT;H11LSL-Cas9 mice. Error bars indicate 95% confidence intervals. The 95% confidence intervals and P values were calculated by bootstrapping. sgRNAs that significantly increase or decrease tumor size are colored as indicated. sgInerts are in gray and the dotted line indicates no effect. Genes and sgRNAs are ordered as in A. The high Pearson correlation coefficient suggests that sgRNAs targeting the same putative tumor suppressor elicit consistent and similar changes in log-normal mean tumor size. All plots represent aggregated data from 47 KT;H11LSL-Cas9 mice.
Inactivation of 14 other genes, including Cdkn2c, Cmtr2, Rb1, Rnf43, Tsc1, and Rbm10, significantly increased tumor growth (Fig. 2A–C; Supplementary Fig. S5). These 14 genes include not only well-established tumor suppressors, such as Rb1 and Cdkn2a, but also many genes that have not been previously considered functional tumor suppressors in lung adenocarcinoma or cancer in general. For example, the effects of inactivating Cmtr2 and Rnf43 were particularly dramatic and unexpected (Fig. 2B). CMTR2 is the sole cap2 2′-O-ribose methylase that modifies the 5′-cap of mRNAs and small nuclear RNAs and is mutated in ∼2.2% of lung adenocarcinomas and 1.4% of all cancers (7, 35) (Supplementary Table S1). No previous studies have investigated its function in cancer, and no commercial or academic cancer gene sequencing panels include CMTR2 (Supplementary Fig. S3A and S3B). RNF43 is a transmembrane E3 ubiquitin ligase that targets WNT receptors for lysosomal degradation (36). RNF43 is frequently mutated across multiple cancer types, including in colorectal and pancreatic adenocarcinoma, in which RNF43 deficiency has been shown to sensitize cancer cells to porcupine inhibitors (37, 38). Thus, our broad survey pinpointed multiple novel functional tumor suppressors in oncogenic KRAS–driven lung cancer and revealed commonality among cancer subtypes.
STAG2 Is a Functional Lung Tumor Suppressor
From our initial analysis of overall tumor growth suppression, STAG2 emerged as a particularly interesting and novel suppressor of lung tumor growth. STAG2 is mutated in ∼4% of lung adenocarcinomas, and cohesin complex components are altered in ∼10% of lung adenocarcinomas (Supplementary Fig. S6A and S6B; Supplementary Table S1). STAG2 has been implicated as a tumor suppressor in bladder cancer, regulates lineage-specific genes in acute myeloid leukemia, and is mutated across diverse cancer types (39–42). However, no previous studies have suggested STAG2 as a critical suppressor of lung cancer growth. To further investigate the tumor-suppressive effect of STAG2, we initiated lung tumors in KT and KT;H11LSL-Cas9 mice with individual Lenti-sgInert/Cre and Lenti-sgStag2/Cre vectors (Supplementary Fig. S7A). Relative to control cohorts, Stag2 inactivation dramatically increased tumor burden (Supplementary Fig. S7B–S7E). Inactivation of Stag2 in lung tumors in KT;H11LSL-Cas9 mice also significantly reduced survival, consistent with its tumor growth–suppressive function (Supplementary Fig. S7F).
To further characterize STAG2-mediated lung tumor growth suppression, we assessed tumor growth in KT mice with Cre/lox-mediated inactivation of Stag2 (Fig. 3A). Stag2 is located on the X chromosome; thus, both heterozygous and homozygous Stag2 deletion in female mice and hemizygous Stag2 deletion in male mice generated tumors that lacked STAG2 protein (Fig. 3B and C). Stag2 inactivation dramatically increased lung tumor burden, and mice with Stag2-deficient tumors had markedly shorter overall survival (Fig. 3D–G). Stag2-deficient and Stag2-proficient lung tumors were atypical adenomatous hyperplasias, adenomas, and early adenocarcinomas that were uniformly NKX2-1/TTF1-positive. Interestingly, some Stag2-deficient tumors had nuclear palisading and were histologically distinct from the tumors that developed in control KT mice (Supplementary Fig. S7G–S7I). STAG2 inactivation in other cancer and cell types is associated with chromosomal instability (43, 44), increased DNA damage (45, 46), and activation of MEK/ERK or cGAS/STING signaling (47, 48). However, immunohistochemistry and analysis of canonical target genes suggest that these mechanisms are unlikely to be major drivers of the increased growth in Stag2-deficient lung cancer (Supplementary Fig. S8A–S8E). Thus, further work will be necessary to determine the molecular mechanisms of tumor suppression mediated by STAG2.
Stag2, inactivation of which increases tumor burden and reduces survival, is frequently low-expressed in human lung adenocarcinoma.A, Cre/lox-mediated Stag2 inactivation promotes KRASG12D-driven lung tumor growth. Lung tumors were initiated in the indicated genotypes of mice with Lenti-Cre and allowed to grow for 15 weeks. B, Representative fluorescence images of lung lobes from the indicated genotypes and genders of mice are shown. Scale bars, 5 mm. C, Lenti-Cre initiated tumors in KT;Stag2flox/flox mice lack STAG2 protein. Scale bar, 50 μm. D, Lung weight from indicated genotypes of mice 15 weeks after tumor initiation with Lenti-Cre. Each dot represents a mouse and the bar is the mean. P values were calculated by Student t test. E, Inactivation of Stag2 increases lung tumor growth in vivo. Representative histology is shown. Genotype and gender are indicated. Scale bars, 1 mm. F, Quantification of tumor area (%) (tumor area/total lung area × 100) on hematoxylin and eosin–stained sections of mouse lungs15 weeks after tumor initiation. Each dot represents a mouse and the bar is the mean. P values were calculated by Student t test. G, Survival curve of mice with KRASG12D-driven lung tumors that are Stag2 wild-type (KT;Stag2wt/wt female and KT;Stag2wt/y male mice), Stag2 heterozygous (KT;Stag2flox/wt), or Stag2 deficient (KT;Stag2flox/flox female and KT;Stag2flox/y male mice). Mouse number, P value, and median survival (in days) are indicated. P values were calculated by comparing each cohort to the Stag2 wild-type cohort (Mantel–Haenszel test). H, Representative STAG2 IHC on human lung adenocarcinomas expressing high (positive) or low (low and negative) STAG2 protein. Scale bars, 100 μm. I, Quantification of STAG2 expression in 479 human lung adenocarcinomas. Data are grouped by tumor grade (left, with lower grade indicating well-differentiated tumors and higher grade indicating poorly differentiated tumors) or by tumor stage (right, classified by TNM staging system). A higher percentage of Stag2low/neg tumors are poorly differentiated (left) and more advanced (right) tumors.
Stag2, inactivation of which increases tumor burden and reduces survival, is frequently low-expressed in human lung adenocarcinoma.A, Cre/lox-mediated Stag2 inactivation promotes KRASG12D-driven lung tumor growth. Lung tumors were initiated in the indicated genotypes of mice with Lenti-Cre and allowed to grow for 15 weeks. B, Representative fluorescence images of lung lobes from the indicated genotypes and genders of mice are shown. Scale bars, 5 mm. C, Lenti-Cre initiated tumors in KT;Stag2flox/flox mice lack STAG2 protein. Scale bar, 50 μm. D, Lung weight from indicated genotypes of mice 15 weeks after tumor initiation with Lenti-Cre. Each dot represents a mouse and the bar is the mean. P values were calculated by Student t test. E, Inactivation of Stag2 increases lung tumor growth in vivo. Representative histology is shown. Genotype and gender are indicated. Scale bars, 1 mm. F, Quantification of tumor area (%) (tumor area/total lung area × 100) on hematoxylin and eosin–stained sections of mouse lungs15 weeks after tumor initiation. Each dot represents a mouse and the bar is the mean. P values were calculated by Student t test. G, Survival curve of mice with KRASG12D-driven lung tumors that are Stag2 wild-type (KT;Stag2wt/wt female and KT;Stag2wt/y male mice), Stag2 heterozygous (KT;Stag2flox/wt), or Stag2 deficient (KT;Stag2flox/flox female and KT;Stag2flox/y male mice). Mouse number, P value, and median survival (in days) are indicated. P values were calculated by comparing each cohort to the Stag2 wild-type cohort (Mantel–Haenszel test). H, Representative STAG2 IHC on human lung adenocarcinomas expressing high (positive) or low (low and negative) STAG2 protein. Scale bars, 100 μm. I, Quantification of STAG2 expression in 479 human lung adenocarcinomas. Data are grouped by tumor grade (left, with lower grade indicating well-differentiated tumors and higher grade indicating poorly differentiated tumors) or by tumor stage (right, classified by TNM staging system). A higher percentage of Stag2low/neg tumors are poorly differentiated (left) and more advanced (right) tumors.
Finally, to further characterize the expression of STAG2 in lung cancer, we performed immunohistochemistry for STAG2 on 479 human lung adenocarcinomas. About 20% of tumors were low or negative for STAG2 protein, suggesting that an even larger fraction of lung adenocarcinomas may be driven by alterations in this pathway (Fig. 3H). Interestingly, STAG2-low/negative lung adenocarcinomas were often more poorly differentiated and advanced (Fig. 3I).
Additional Tumor-Suppressive Effects Emerge at Later Time Points
To gain further insights into the dynamics of tumor suppression in lung cancer, we assessed tumor suppressor gene function at a later time point after tumor initiation. We reasoned that allowing tumors to grow for a longer period of time might uncover greater magnitudes of growth suppression for genes that initially had modest effects and could highlight additional tumor suppressors that play more important roles only at later stages of tumor growth. To allow mice to survive for a longer period of time after tumor initiation, we generated a second pool of Lenti-sgRNA/Cre vectors, which excluded those targeting Lkb1, Pten, Setd2, Nf1, Trp53, Stag2, Cdkn2c, and Rb1 that collectively accounted for more than half of the total tumor burden (Lenti-sgTS85/Cre; Fig. 4A). We initiated tumors in KT;H11LSL-Cas9 mice with a titer of Lenti-sgTS85/Cre that would allow them to survive for 26 weeks while maximizing tumor number to achieve reasonable statistical power (Fig. 4A; Supplementary Fig. S9A; Methods). As controls, we also initiated tumors with Lenti-sgTS85/Cre pool in KT;H11LSL-Cas9 and KT mice and analyzed them after 15 weeks (Fig. 4A).
Exaggeration of tumor phenotypes and emergence of more functional tumor suppressors over time. A, Schematic of tumor initiation with a pool of 85 barcoded Lenti-sgRNA/Cre vectors (Lenti-sgTS85/Cre) that exclude vectors targeting eight tumor suppressor genes (in gray and crossed out) from the Lenti-sgTS102/Cre pool that collectively account for ∼60% of total tumor burden. Each gene is targeted with two sgRNAs. Mouse genotype, mouse number, and titer of lentiviral vectors delivered to each mouse are indicated. Tuba-seq was performed on each tumor-bearing lung at the indicated time after tumor initiation. B, Volcano plot of the impact of inactivating each putative tumor suppressor gene on relative tumor burden. Each dot represents an sgRNA. Genes for which both sgRNA increase tumor burden are colored. C and D, The impact of inactivating each gene on the size of the 95th percentile tumor (C) and log-normal mean (D) at 15 weeks (Lenti-sgTS102/Cre 15 weeks) and 26 weeks (Lenti-sgTS85/Cre 26 weeks) after tumor initiation is shown. Each dot represents an sgRNA. Statistics are calculated from aggregating all tumors from 40 KT;H11LSL-Cas9 (26 weeks) and 47 KT;H11LSL-Cas9 (15 weeks) mice. E, Heat map of the tumor-suppressive effects of six genes that emerge as suppressors of tumor growth at the later time point. Colors indicate the impact of inactivating each gene on tumor size at 15 weeks (Lenti-sgTS102/Cre 15 weeks and Lenti-sgTS85/Cre 15 weeks) and 26 weeks (Lenti-sgTS85/Cre 26 weeks) after tumor initiation, and sizes of the tiles indicate statistical significance levels. F, Sizes of tumors at the indicated percentiles for each Lenti-sgRNA/Cre vector relative to that of sgInert tumors in KT;H11LSL-Cas9 mice. Error bars indicate 95% confidence intervals. Percentiles that are significantly different from the average of sgInerts are in color. Data for all genes are shown in Supplementary Fig. S9B.
Exaggeration of tumor phenotypes and emergence of more functional tumor suppressors over time. A, Schematic of tumor initiation with a pool of 85 barcoded Lenti-sgRNA/Cre vectors (Lenti-sgTS85/Cre) that exclude vectors targeting eight tumor suppressor genes (in gray and crossed out) from the Lenti-sgTS102/Cre pool that collectively account for ∼60% of total tumor burden. Each gene is targeted with two sgRNAs. Mouse genotype, mouse number, and titer of lentiviral vectors delivered to each mouse are indicated. Tuba-seq was performed on each tumor-bearing lung at the indicated time after tumor initiation. B, Volcano plot of the impact of inactivating each putative tumor suppressor gene on relative tumor burden. Each dot represents an sgRNA. Genes for which both sgRNA increase tumor burden are colored. C and D, The impact of inactivating each gene on the size of the 95th percentile tumor (C) and log-normal mean (D) at 15 weeks (Lenti-sgTS102/Cre 15 weeks) and 26 weeks (Lenti-sgTS85/Cre 26 weeks) after tumor initiation is shown. Each dot represents an sgRNA. Statistics are calculated from aggregating all tumors from 40 KT;H11LSL-Cas9 (26 weeks) and 47 KT;H11LSL-Cas9 (15 weeks) mice. E, Heat map of the tumor-suppressive effects of six genes that emerge as suppressors of tumor growth at the later time point. Colors indicate the impact of inactivating each gene on tumor size at 15 weeks (Lenti-sgTS102/Cre 15 weeks and Lenti-sgTS85/Cre 15 weeks) and 26 weeks (Lenti-sgTS85/Cre 26 weeks) after tumor initiation, and sizes of the tiles indicate statistical significance levels. F, Sizes of tumors at the indicated percentiles for each Lenti-sgRNA/Cre vector relative to that of sgInert tumors in KT;H11LSL-Cas9 mice. Error bars indicate 95% confidence intervals. Percentiles that are significantly different from the average of sgInerts are in color. Data for all genes are shown in Supplementary Fig. S9B.
After 26 weeks of tumor growth, inactivation of Cdkn2a, Dnmt3a, Cmtr2, Kdm6a, and Ncoa6 significantly increased tumor burden (Fig. 4B). Furthermore, inactivation of Rbm10, Cmtr2, Rnf43, and Tsc1 still increased tumor sizes at defined percentiles of the distribution as well as the log-normal mean tumor size at this later time point (Supplementary Fig. S9B). These results confirm the tumor-suppressive function of these genes. Importantly, inactivation of several other genes that had marginal to no effects on tumor sizes after 15 weeks of tumor growth, including Keap1, Kdm6a, Ncoa6, Cdkn2a, Dnmt3a, and Dot1l, broadly increased tumor sizes after 26 weeks of tumor growth (Fig. 4C–F). Thus, analysis of growth metrics at multiple time points after tumor initiation can provide temporal resolution of tumor suppressor gene effects.
Tuba-seq Captures Additional Aspects of Tumor Suppressor Gene Function
In addition to uncovering tumor suppressor genes that limit overall growth, our methods can quantify other aspects of cancer initiation and progression affected by these genes and pathways. The relative tumor burden induced by each Lenti-sgRNA/Cre vector was mostly consistent with the growth effects uncovered using tumor sizes at defined percentiles (Supplementary Fig. S10A). However, the effects of inactivating some genes on relative tumor burden were disproportionately large (Supplementary Fig. S10A and S10B). For example, Trp53 was clearly a tumor suppressor based on relative tumor burden, but p53 inactivation did not greatly increase overall tumor growth as assessed by log-normal mean or tumor sizes up to the 95th percentile tumor (Supplementary Fig. S10A). Inactivation of several other genes also had much more significant and dramatic effects on relative tumor burden than on tumor sizes (Supplementary Fig. S10B and S10C). These disproportionate increases in relative tumor burden could result from genotype-specific increases in tumor number and/or the sizes of the very largest tumors, neither of which are captured well by log-normal mean or tumor sizes at defined percentiles of the tumor size distribution.
Many Tumor Suppressors Constrain Tumor Initiation
Our experimental design, in which we initiated tumors in cohorts of KT;H11LSL-Cas9 and KT mice with the same pool of lentiviral vectors, enabled us for the first time to use Tuba-seq to uncover the impact of each putative tumor suppressor gene on tumor initiation and very early oncogenic KRAS–driven epithelial expansion (Supplementary Fig. S4C and Methods). The genetic alterations that drive the development of very early epithelial expansions are poorly understood, yet these events influence tumor incidence and set the stage for all subsequent events during cancer evolution. In vivo mouse models are particularly well suited to study the effects of genetic alterations on these early events.
Fifteen weeks after tumor initiation, inactivation of many genes, including Lkb1, Setd2, and Stag2, which had some of the most dramatic effects on tumor growth, did not increase tumor number (defined as the number of clonal expansions with more than 200 cells; Fig. 5A; Supplementary Fig. S4C and Methods). However, Pten inactivation increased tumor number by ∼4-fold, suggesting that at least three fourths of epithelial cells expressing oncogenic KRASG12D fail to expand beyond 200 cells, if at all (Fig. 5A and B). Tsc1 inactivation also increases tumor number, albeit to a lesser extent, consistent with TSC1 suppressing mTOR downstream of PI3K (49). Inactivation of Nf1, Rasa1, and Trp53 also increased tumor number, thus implicating several signaling pathways in the earliest stages of lung tumor development (Fig. 5A). Strikingly, inactivation of four members of the COMPASS complex (Kdm6a, Ncoa6, Kmt2c/Mll4, and Kmt2d/Mll3; refs. 50, 51) all increased tumor number (Fig. 5A). The importance of histone H3K4 methylation mediated by this complex is further substantiated by the mutation of at least one member of this complex in 11.7% to 24.2% of human lung adenocarcinomas (Fig. 5C and D; ref. 2). Importantly, genes that limit tumor initiation and those that constrain tumor growth are often independent, suggesting that these facets of tumor suppression can represent distinct functions (Supplementary Fig. S11A).
Tumor initiation is inhibited by diverse tumor suppressor genes independent of their effects on tumor growth. A, Inactivation of many tumor suppressor genes increases tumor number, highlighting pathways that normally constrain the earliest steps of carcinogenesis. The effect of each sgRNA on tumor number 15 weeks after tumor initiation with Lenti-sgTS102/Cre in KT;H11LSL-Cas9 mice is shown. Error bars indicate 95% confidence intervals. The 95% confidence intervals and P values were calculated by bootstrapping. sgRNAs that significantly increase or decrease tumor number are colored as indicated. sgInerts are in gray and the dotted line indicates no effect. Genes and sgRNAs are ordered as in Fig. 2A. B, Genotype-specific effects on growth (represented by the size of the tumor at the 95th percentile) and tumor number can be independent aspects of tumor suppression. C and D, Mutation frequency of members of the COMPASS complex in human lung adenocarcinoma. Data are shown as the number of patients with mutations in one or more of the COMPASS complex subunits/total patient number from GENIE (C) as well as TCGA and TRACERx (D). Data from GENIE are based on panel sequencing and therefore do not include data on NCOA6. Data from TRACERx are from multiregion sequencing where we report the number of tumors that had any of these four genes mutated in one or more regions. E, The effect of each sgRNA on tumor number 26 weeks after tumor initiation with Lenti-sgTS85/Cre in KT;H11LSL-Cas9 mice is shown. Error bars indicate 95% confidence intervals. The 95% confidence intervals and P values were calculated by bootstrapping. sgRNAs that significantly increase or decrease tumor number are colored as indicated. sgInerts are in gray and the dotted line indicates no effect. Genes and sgRNAs are ordered as in A. F, Effects of tumor suppressor gene inactivation on tumor number are highly reproducible. The impact of inactivating each gene on tumor number at 15 weeks (Lenti-sgTS102/Cre 15 weeks) and 26 weeks (Lenti-sgTS85/Cre 26 weeks) after tumor initiation is shown. Each dot represents an sgRNA. Statistics are calculated from aggregating all tumors from all mice in each group in each experiment. Pearson correlation coefficient (r) shows correlation.
Tumor initiation is inhibited by diverse tumor suppressor genes independent of their effects on tumor growth. A, Inactivation of many tumor suppressor genes increases tumor number, highlighting pathways that normally constrain the earliest steps of carcinogenesis. The effect of each sgRNA on tumor number 15 weeks after tumor initiation with Lenti-sgTS102/Cre in KT;H11LSL-Cas9 mice is shown. Error bars indicate 95% confidence intervals. The 95% confidence intervals and P values were calculated by bootstrapping. sgRNAs that significantly increase or decrease tumor number are colored as indicated. sgInerts are in gray and the dotted line indicates no effect. Genes and sgRNAs are ordered as in Fig. 2A. B, Genotype-specific effects on growth (represented by the size of the tumor at the 95th percentile) and tumor number can be independent aspects of tumor suppression. C and D, Mutation frequency of members of the COMPASS complex in human lung adenocarcinoma. Data are shown as the number of patients with mutations in one or more of the COMPASS complex subunits/total patient number from GENIE (C) as well as TCGA and TRACERx (D). Data from GENIE are based on panel sequencing and therefore do not include data on NCOA6. Data from TRACERx are from multiregion sequencing where we report the number of tumors that had any of these four genes mutated in one or more regions. E, The effect of each sgRNA on tumor number 26 weeks after tumor initiation with Lenti-sgTS85/Cre in KT;H11LSL-Cas9 mice is shown. Error bars indicate 95% confidence intervals. The 95% confidence intervals and P values were calculated by bootstrapping. sgRNAs that significantly increase or decrease tumor number are colored as indicated. sgInerts are in gray and the dotted line indicates no effect. Genes and sgRNAs are ordered as in A. F, Effects of tumor suppressor gene inactivation on tumor number are highly reproducible. The impact of inactivating each gene on tumor number at 15 weeks (Lenti-sgTS102/Cre 15 weeks) and 26 weeks (Lenti-sgTS85/Cre 26 weeks) after tumor initiation is shown. Each dot represents an sgRNA. Statistics are calculated from aggregating all tumors from all mice in each group in each experiment. Pearson correlation coefficient (r) shows correlation.
Analysis of the effect of each genotype on tumor number in mice with tumors initiated with the Lenti-sg85/Cre pool (at both 15 and 26 weeks after tumor initiation) provided us with the opportunity to further validate the effect of tumor suppressor inactivation on tumor initiation and early growth (Fig. 5E; Supplementary Fig. S11B and S11C). The effects of inactivating each tumor suppressor gene on relative tumor number were highly correlated across all three data sets (Fig. 5F; Supplementary Fig. S11D and S11E). Several genes, including Cdkn2a, Dnmt3a, Kdm6a, and Ncoa6, that initially increased only tumor number also increased overall growth fitness at the later time point. This suggests some link between the cellular changes that enable normal epithelial cells to break through the constraints of early hyperplastic growth and the greater fitness in the resulting tumors (Figs. 4F and 5F; Supplementary Fig. S9B).
Tumor Suppressor Inactivation Allows the Emergence of Rare but Very Large Tumors
Next, we took advantage of the per-tumor resolution of our Tuba-seq data to quantify the impact of inactivating each gene on the generation of exceptionally large tumors. In addition to the effects of tumor suppressor gene inactivation on overall tumor growth and tumor initiation, the development of exceptionally large tumors is suggestive of genotypes that promote or allow additional alterations to drive aggressive tumor growth. We previously found that one major effect of Trp53 deficiency is the generation of exceptionally large tumors (26, 27). Using metrics such as the Hill estimator (a measure of the heavy-tailedness of a distribution; ref. 52), we quantified the extent to which Trp53 inactivation enables the emergence of infrequent but exceptionally large tumors after 15 weeks of tumor growth (Fig. 6A and B; Supplementary Fig. S12A). The effect of Trp53 inactivation is consistent with many previous reports documenting the emergence of large lung tumors in KrasLSL-G12D/+;Trp53flox/flox mice (32, 53–55). These analyses also showed that inactivation of Cdkn2a and the DNA methyltransferase Dnmt3a might allow some tumors to grow to disproportionately large sizes (Fig. 6A and B; Supplementary Fig. S12A).
Loss of Trp53, Cdkn2a, and Dnmt3a result in the development of rare yet exceptionally large tumors. A, Plot of tumor sizes for each indicated sgRNA in KT;H11LSL-Cas9 mice at 15 weeks. Each dot represents a tumor and the area of the dot scales with neoplastic cell number within the tumor. For better visualization, an equal number of tumors (n = 1,160) are shown for each sgRNA. B, Volcano plot of the impact of inactivating each putative tumor suppressor gene on the development of exceptionally large tumors (Hill estimator compares tumors above the 95th percentile with those at the 95th percentile to quantify the relative size of tumors in the tail of the distribution). Trp53- and Dnmt3a-targeted tumors are heavy-tailed, suggesting that loss of these genes promoted the emergence of exceptionally large tumors. Each dot represents an sgRNA. C, Plot of tumor sizes for each indicated sgRNA in KT;H11LSL-Cas9 mice at 26 weeks. Each dot indicates a tumor, and the area of the dot indicates neoplastic cell number within the tumor. An equal number of tumors (n = 814 tumors randomly sampled) are shown for each sgRNA. D, Volcano plot of the impact of inactivating each putative tumor suppressor gene on the development of infrequent exceptionally large tumors (Hill estimator). Each dot represents an sgRNA. Statistics are calculated from aggregating all tumors from 40 KT;H11LSL-Cas9 (26 weeks) mice. E, Inactivation of Dnmt3a and Cdkn2a generates tumor size distributions with heavy tails. Probability density plots for tumor sizes show the profile of aggregated tumors with sgInerts as well as individual sgRNAs targeting either Dnmt3a or Cdkn2a. Data are aggregated from all tumors from 40 KT;H11LSL-Cas9 (26 weeks) mice.
Loss of Trp53, Cdkn2a, and Dnmt3a result in the development of rare yet exceptionally large tumors. A, Plot of tumor sizes for each indicated sgRNA in KT;H11LSL-Cas9 mice at 15 weeks. Each dot represents a tumor and the area of the dot scales with neoplastic cell number within the tumor. For better visualization, an equal number of tumors (n = 1,160) are shown for each sgRNA. B, Volcano plot of the impact of inactivating each putative tumor suppressor gene on the development of exceptionally large tumors (Hill estimator compares tumors above the 95th percentile with those at the 95th percentile to quantify the relative size of tumors in the tail of the distribution). Trp53- and Dnmt3a-targeted tumors are heavy-tailed, suggesting that loss of these genes promoted the emergence of exceptionally large tumors. Each dot represents an sgRNA. C, Plot of tumor sizes for each indicated sgRNA in KT;H11LSL-Cas9 mice at 26 weeks. Each dot indicates a tumor, and the area of the dot indicates neoplastic cell number within the tumor. An equal number of tumors (n = 814 tumors randomly sampled) are shown for each sgRNA. D, Volcano plot of the impact of inactivating each putative tumor suppressor gene on the development of infrequent exceptionally large tumors (Hill estimator). Each dot represents an sgRNA. Statistics are calculated from aggregating all tumors from 40 KT;H11LSL-Cas9 (26 weeks) mice. E, Inactivation of Dnmt3a and Cdkn2a generates tumor size distributions with heavy tails. Probability density plots for tumor sizes show the profile of aggregated tumors with sgInerts as well as individual sgRNAs targeting either Dnmt3a or Cdkn2a. Data are aggregated from all tumors from 40 KT;H11LSL-Cas9 (26 weeks) mice.
To further investigate the effects of tumor suppressor gene inactivation on the emergence of exceptionally large tumors, we determined which genotypes generate heavy-tailed tumor size distribution after 26 weeks of tumor growth. Analysis of the distributions of tumor sizes specifically highlighted the development of exceptionally large Dnmt3a- and Cdkn2a-targeted tumors (Fig. 6C–E; Supplementary Fig. S12B–S12D). Both sgRNAs targeting Cdkn2a are anticipated to inactivate both INK4A and ARF; therefore, the effect of Cdkn2a inactivation could reflect the combined deregulation of the Rb and p53 pathways, consistent with our observation that p53 inactivation generates a heavy-tailed distribution (Fig. 6A and B; Supplementary Fig. S12A; refs. 26, 27). The emergence of very large Cdkn2a- and Dnmt3a-deficient tumors is consistent with the increased lung tumor burden in oncogenic KrasLSL-G12D-driven tumors with Cre/lox-mediated inactivation of these genes (56, 57). However, the per-tumor resolution of our data suggests that the inactivation of INK4A/ARF or the DNA methyltransferase DNMT3A enables the emergence of rare but exceptionally large tumors while having only a modest impact on the growth of most tumors (Fig. 6E; Supplementary Fig. S12C). Therefore, the role of tumor suppressors in preventing the development of exceptionally large tumors can be independent of their roles in regulating tumor initiation and overall growth during cancer evolution.
Limited Effects of Overall Tumor Burden and Sex on Tumor Suppressor Function
Our high-resolution data across multiple facets of tumor suppression in principle allow for quantification of the effects of other variables on tumor suppressor effects. Given that overall tumor burden varies across mice and that we initiated tumors in mice of both sexes, we assessed how these variables influence tumor suppressor effects. To uncover whether overall tumor burden influences genotype-specific effects, we divided our KT;H11LSL-Cas9 mice with Lenti-sgTS102/Cre-initiated tumors into three groups with low, medium, and high tumor burden and reassessed multiple metrics of tumor initiation and growth (Supplementary Fig. S13A). Very few genotype-specific tumor-suppressive effects were influenced by overall tumor burden, suggesting that our results are largely unaffected by potential differences in paracrine or physical interactions that change with tumor density (Supplementary Fig. S13B–S13E).
There is a growing interest in understanding sex-specific effects on all aspects of carcinogenesis. Our data derived from both male and female mice allowed us to investigate sex-specific differences in tumor suppression. Inactivation of most genes, including those on the X chromosome, had similar effects on tumor growth and tumor number in male and female mice (Supplementary Fig. S14A–S14D). Thus, tumor suppressor effects in lung cancer are not dramatically affected by differences in the host environment driven by sex. This was particularly illuminating for Kdm6a, which is an X-linked gene that has both H3K27me3 demethylase and nonenzymatic functions (58). Its nonenzymatic function can be compensated for by its paralog UTY on the Y chromosome, and thus different effects in male and female mice have been used to provide insight into the molecular function of KDM6A (58). Kdm6a inactivation increased tumor number similarly in male and female mice. The effects were consistent in our data at 15 and 26 weeks after tumor initiation, suggesting that the impact of KDM6A inactivation is most likely driven by loss of its enzymatic function (Supplementary Fig. S14E–S14H).
Evaluation of Sensitivity and Specificity
To better estimate the impact of false negatives and false positives on our data, we used all of our data sets to estimate the true-positive rate (Methods). Within all of our data sets, the effects of sgRNAs targeting the same gene were concordant across multiple metrics, consistent with on-target effects (Figs. 2 and 4; Supplementary Fig. S15A–S15F). For instance, in our experiment using Lenti-sgTS102/Cre pool, when one sgRNA showed a significant tumor-suppressive effect (nominal P < 0.05), the probability to redetect the significant effect using the other guide was above 89% for all metrics assessed (Supplementary Table S3). Thus, the probability that both sgRNAs fail to uncover a functional tumor suppressor that has a similar effect to the tumor suppressors identified in our analysis is below 5% (Supplementary Table S3). Note that for the eight major tumor suppressor genes that were excluded from the Lenti-sgTS85/Cre pool, significant effects for both sgRNAs were uncovered in every case. Given these results and the targeting of each putative tumor suppressor gene with two sgRNAs, it is unlikely that functional tumor suppressors were missed for technical reasons. Furthermore, analysis of sgRNA cutting in cells in culture showed comparable efficiency of sgRNAs targeting genes that emerged as tumor suppressors and those that did not (Supplementary Fig. S15G–S15I). Finally, power calculations using our data suggest that an even larger number of genes could be assessed using reasonable numbers of mice using these methods (Supplementary Fig. S16A–S16C).
Human Mutational Data, Cell Line Studies, andIn Vivo Functional Studies Are Complementary in Defining a Catalog of Tumor Suppressors
The candidate tumor suppressor genes that we assessed were chosen based on existing human mutational data; however, each gene has different levels of correlative data supporting its function as a tumor suppressor (Supplementary Table S1). We explored whether effects on tumorigenesis within the autochthonous environment could be predicted either by human mutation data or through the analysis of human cell lines. Several strong functional tumor suppressors did not stand out based on the human mutational frequency data, and genes such as STAG2, CMTR2, and CDKN2C were not often predicted to be tumor suppressor genes based on human mutational data (Fig. 2A; Supplementary Fig. S17A–S17G). Thus, computational predictions of tumor suppressor function from mutational data alone (including statistical methods that integrate background mutation rate corrections as well as function- and structure-based impact predictions) nominate some but not all functional tumor suppressors.
Analysis of data from the Dependency Map (59), in which genome-scale knockout screens were performed across diverse cancer cell lines, was also revealing. Inactivation of several top functional tumor suppressors, including PTEN, CDKN2C, RB1, and RNF43, increased lung adenocarcinoma cell line growth as expected (Supplementary Fig. S17H). However, inactivation of several other major functional tumor suppressors, including LKB1, SETD2, and STAG2, paradoxically decreased cancer cell growth in culture (Supplementary Fig. S17H). The effects of inactivating several modest tumor suppressors were concordant between the human cell lines and in vivo mouse model data, although inactivation of some genes, including CMTR2, RBM10, and KEAP1, had variable or growth-suppressive effects on cancer cells in culture (Fig. 4B; Supplementary Fig. S17H). Collectively, these results underscore the differences in the fitness landscape in cell lines and indicate that in vivo studies can complement these analyses.
Discussion
The enormous genomic diversity in cancer, even within tumors of the same subtype, creates a challenge for identifying driver genes and deciphering their roles in tumor development. Given the sample sizes of cancer genome sequencing studies, variation in genomic features such as location, expression, and composition will continue to make computational predictions of tumor suppressor function from mutation data difficult, except for a subset of genes (9, 60, 61). Moreover, mutation frequencies alone cannot easily define the importance of each tumor suppressor gene and even less so be used to glean their mode of action. Indeed, even rarely mutated tumor suppressor genes can have large consequences when inactivated, with the rarity of mutation being driven by mutational cold spots, epistatic interactions, and biological context (9, 62) rather than by the magnitude of their inhibitory function (Supplementary Fig. S17A). Thus, although experiments using model organisms could be affected by species-specific effects, in vivo functional studies that include autochthonous tumor initiation, growth, and progression are an important complement to the computational investigation of tumor suppressor inactivation in human tumors (13, 20, 21).
Carcinogenesis is broadly affected by different aspects of the in vivo environment. By enhancing the throughput, sensitivity, and precision of Tuba-seq (26, 27), we quantify the effects of inactivating a diverse panel of putative tumor suppressor genes in an autochthonous mouse model of oncogenic KRAS–driven lung cancer. The parallel analysis of ∼50 different genotypes not only uncovered previously uncharacterized functional tumor suppressor genes but also provided new insights into the landscape of tumor suppression and multiple modes of action of tumor suppressor genes (Fig. 7A and B). We show that tumor suppression is unexpectedly complex and multifaceted, with some genes suppressing tumor initiation, some constraining overall tumor growth, and others limiting the emergence of a small proportion of unusually fast-growing tumors (Fig. 7A and B). Furthermore, although some genes affect only a single feature of carcinogenesis, others affect multiple facets of tumor evolution to varying extents (Fig. 7C). The relative importance of these genes can also change during the course of carcinogenesis (Fig. 7B and C). Understanding the impact of tumor suppressors that primarily regulate certain aspects of carcinogenesis may have a unique value for cancer prevention, early detection, and therapeutic targeting. The discovery of such functional complexity points to shifting challenges during different stages of carcinogenesis. Thus, tumor suppressors are not simply “brakes” on proliferation but rather contextually and temporally dependent genetic modifiers of different phases of carcinogenesis.
Tumor suppressors constrain tumorigenesis at different stages and to different levels. A, Radar plots of representative genes whose inactivation affects tumor size at the 95th percentile (relative to sgInerts, indicating increased overall growth), tumor number (relative to sgInerts, indicating increased tumor initiation), and Hill estimator (relative to sgInerts, indicating increased rare large tumors). Tumor suppressors suppress different aspects of tumor development. B, Heat map summarizing the tumor size at the 95th percentile (relative to sgInerts), tumor number (relative to sgInerts), and Hill estimator (relative to sgInerts) of the functional tumor suppressor genes. Color scale is indicated on the side. Bolded circles indicate bootstrap P < 0.05. Although the sizes of Ubr5-, Tsc1-, Kdm6a-, and Ncoa6-deficient tumors are not significantly different from control tumors at the 95th percentile, they are significantly greater across multiple percentiles at 26 weeks, and thus they are also considered genes that suppress tumor growth. C, Summary schematic of a tumor suppression map in lung adenocarcinoma based on our data.
Tumor suppressors constrain tumorigenesis at different stages and to different levels. A, Radar plots of representative genes whose inactivation affects tumor size at the 95th percentile (relative to sgInerts, indicating increased overall growth), tumor number (relative to sgInerts, indicating increased tumor initiation), and Hill estimator (relative to sgInerts, indicating increased rare large tumors). Tumor suppressors suppress different aspects of tumor development. B, Heat map summarizing the tumor size at the 95th percentile (relative to sgInerts), tumor number (relative to sgInerts), and Hill estimator (relative to sgInerts) of the functional tumor suppressor genes. Color scale is indicated on the side. Bolded circles indicate bootstrap P < 0.05. Although the sizes of Ubr5-, Tsc1-, Kdm6a-, and Ncoa6-deficient tumors are not significantly different from control tumors at the 95th percentile, they are significantly greater across multiple percentiles at 26 weeks, and thus they are also considered genes that suppress tumor growth. C, Summary schematic of a tumor suppression map in lung adenocarcinoma based on our data.
Our results are largely consistent with previous studies that assessed some of these genes individually using similar in vivo mouse models of lung cancer (22, 26, 31–34, 51, 63, 64). However, single-gene approaches and quantification of overall tumor burden alone are limited in their ability to uncover the modes of tumor suppression and do not enable direct comparison across many genotypes. For example, although Lkb1, Pten, Kdm6a, Dnmt3a, and Trp53 inactivations each increase overall tumor burden, our quantitative, multiplexed design and computational platform uniquely enabled the deconvolution of different aspects of tumor suppression (Fig. 7A).
We show that the inactivation of many understudied genes has major effects on tumor growth (Fig. 7C; Supplementary Fig. S3). Identifying additional genes that are fundamentally important in suppressing carcinogenesis, including those that are less frequently mutated in human lung adenocarcinoma, can highlight key molecular and cellular processes that are critical in cancer. Furthermore, alterations in cis-regulatory elements, epigenetic silencing, and mutations in other members of the same complexes or pathways likely dysregulate these processes in a much higher percentage of tumors. Thus, these types of in vivo findings not only suggest the importance of certain genes but also more broadly uncover underappreciated cellular processes that limit cancer development. Our findings nominate several novel genes and key pathways that should be investigated in further mechanistic detail. In particular, the mechanisms by which STAG2 inactivation drives lung cancer growth remain to be elucidated.
One key approach used to implicate the context dependency of tumor suppressor function is the analysis of mutual exclusivity in human data (65). Interestingly, our data demonstrate that genes that trend toward mutual exclusivity with oncogenic KRAS mutations, such as NF1 and PTEN, are still important suppressors of oncogenic KRAS–driven lung cancer (Supplementary Fig. S17B). Such statistical trends toward mutual exclusivity should not be misinterpreted as the lack of tumor-suppressive effect of these genes in oncogenic KRAS–driven lung cancer, and more generally, these types of patterns in mutation data should be interpreted with caution (66). Instead, these patterns likely reflect complex epistatic interactions in which context dependence drives frequencies and mutation spectra (9, 62).
Our data, coupled with human lung adenocarcinoma sequencing studies, provide the most comprehensive map of in vivo tumor suppressor gene function for cancer (Fig. 7C). Given the quantitative and cost-effective nature of Tuba-seq, even broader studies of many other genes and combinations of genomic alterations may be warranted. Moreover, studies across different genetic and environmental contexts may further elucidate and refine the modality and context dependence of tumor suppressor gene effects (27, 67, 68). This should lead to a more thorough understanding of the interactions between cell-intrinsic and cell-extrinsic processes that contribute to the etiology and evolution of lung cancer.
Methods
Selection of Candidate Tumor Suppressor Genes for This Study
To select candidate genes to assess in vivo using Tuba-seq (and to complement genomics and cell biology approaches), we generated a highly human-curated panel that integrates many different considerations.
Known lung adenocarcinoma driver tumor suppressor genes at >5% mutational frequency (such as TP53, LKB1, CDKN2A, KEAP1) from TCGA, AACR Project GENIE, and TRACERx data sets, which were previously assessed by Tuba-seq, were included as positive controls. We included genes that tend to co-occur with oncogenic KRAS mutations and those that do not. We also included genes that have been categorized as tumor suppressor genes in other cancer types with >5% mutational frequency in lung (such as KDM6A and FAT1), even if they are not predicted to be involved in lung adenocarcinoma (Fig. 1A; Supplementary Fig. S1; Supplementary Table S1).
We also considered the distribution of mutations within genes (Fig. 1B), including low-mutation frequency genes (<5%) that show potential clonal or subclonal bias from the TRACERx data set (Supplementary Table S1), genes with discrepancies in scoring of potential driver activity (Supplementary Fig. S2), and genes that represent biological processes or functions commonly associated with carcinogenesis (Supplementary Fig. S3). From a curated survey of literature, candidate genes that have been discussed as cancer driver genes without much or any functional data were also included (Supplementary Fig. S4).
Analysis of Human Lung Adenocarcinoma Cancer Genome Sequencing Data
Mutation frequencies and other information for the 48-gene panel of putative candidate tumor suppressor genes (TSG) are available from multiple cancer data sets and their analyses in TRACERx (6), GENIE (2), and TCGA (7, 69, 70). Oncogenes are characterized by missense point mutations arising in mutational hotspots. In contrast, TSGs are characterized by protein truncating mutations (nonsense and frameshifts) that are more dispersed across the transcript. Moreover, when nonsense and frameshift mutations arise in oncogenes, they tend to truncate C-terminal domains and occur toward the end of the transcript. To identify putative TSGs, we characterized all genes in this survey by these two genetic features: mutational hotspots and the fraction of protein truncated per mutation. We used all point mutations and short insertion and deletions found within the TCGA lung adenocarcinoma (7) and Catalogue of Somatic Mutations in Cancer (71) databases. The extent of mutational hotspots within a gene was determined using a normalized measure of dispersion (Green's contagion) of the number of missense mutations observed within all five residue rolling windows in each gene: (σ2/μ − 1)/(μN − 1), where μ is the mean number of missense mutations observed within each window, σ2 is the unbiased estimator of the variance, and N is the number of missense mutations. Green's contagion and the five-residue window size were chosen because they maximized the accuracy of classification of known oncogenes and tumor suppressors. Larger values of Green's contagion suggest that mutations are clumping at a few residues within the protein and that the mutant gene is likely oncogenic. This measure has a value of zero when mutations are randomly dispersed throughout the gene and can be negative when mutations are underdispersed. The fraction of protein truncated per mutation is the mean number of amino acids lost per nonsynonymous mutation. It is calculated by simply averaging the fraction of a transcript lost due to each frameshift and nonsense mutation while assigning a value of zero to all missense mutations in this collective average.
To summarize what has previously been described about the biological functions of the candidate genes, we used driver gene scores from attempts to discover cancer driver genes using multiple approaches, such as weighted consensus across multiple tools (8) and prediction by machine learning (29). We also collated the known biological processes and subcellular localization of the 48 genes from the Gene Ontology database (release date 2019–07–01; ref. 30).
For co-occurrence of mutations in KRAS and each selected gene, the odds ratio [equals (Nneither were mutated * NBoth were mutated)/(Nonly KRAS is mutated *Nonly selected gene is mutated)] and P value (one-sided Fisher exact test) were available on cBioPortal.org. In total, 566 lung adenocarcinoma cases from TCGA Pan-Cancer Atlas and 8,522 lung adenocarcinoma samples from GENIE Cohort v8 were analyzed. Note that NCOA6, ATF7IP, CMTR2, and UBR5 are not profiled in any GENIE lung adenocarcinoma cases and hence were excluded from the analysis. For the fitting of a simple linear regression between measured phenotypes and observed clinical parameters, we used data from mutation timing and clonality in lung adenocarcinomas that have been previously described (6, 70).
Analysis of Publications Suggesting Tumor-Suppressive Function of Each Putative TSG in Lung Cancer
A list of articles related to the gene was accessed through the “Bibliography” section of NCBI Gene (https://www.ncbi.nlm.nih.gov/gene/). Subsequently, “lung cancer” and/or “tumor suppressor” were used as the keywords to refine the search.
Calculation of Gene Inclusion in Gene-Sequencing Panels
GENIE panel sequencing information was compiled through the GENIE 6.1 Public Release. We first generated a list of panels that provided data from patients with “cancer type detailed” listed as “lung adenocarcinoma,” “lung adenocarcinoma in situ,” or “lung adenosquamous carcinoma” by filtering the data_clinical_sample.txt file. Then, by parsing the genie_combined.bed file, we generated a list of “screened” genes for each panel, which refers to genes that have “Feature_Type” listed as “exon” and “includeInPanel” listed as “True.” This list was then used to categorize our pool of tumor suppressors as either “screened” or “unscreened” by these sequencing panels. Stanford Solid Tumor Actionable Mutation Panel (STAMP) and FoundationOne CDx sequencing panels were obtained from the official websites.
Design, Generation, Barcoding, and Production of Lentiviral Vectors
The sgRNA sequences targeting the putative tumor suppressor genes were designed using Desktop Genetic's Guide Picker (ref. 72; https://genomesunzipped.org/best-genealogy-software/) to prioritize on-target activity (score of >0.6; ref. 73), specificity (score of >0.6; ref. 74), likelihood of generating frameshift indels (score of >0.6; ref. 75), targeting of maximal number of transcript isoforms, no homopolymer runs in the sgRNA, and no extremes in GC content of sgRNA (0.4–0.75), as detailed in Supplementary Table S2.
The Lenti-U6-sgRNA-sgID-barcode-Pgk-Cre vector was modified from our previous work (26) as follows. The sgRNA sequence of the previously described pLenti-sgNT1/Cre (Addgene #66895) vector was replaced with GCGAGGTATTACCGGCGTATCATCCGCG by site-directed mutagenesis to generate pLenti-BaeI-Pgk-Cre. The replacement sequence contains a recognition site for the type IIS restriction endonuclease BaeI, allowing for quick replacement of the sgRNA sequence. To generate each desired vector, forward and reverse single-stranded oligonucleotides containing the sgRNA sequence and complementary overhangs are annealed and ligated into the BaeI-linearized pLenti-BaeI-Pgk-Cre vector using T4 DNA ligase. The barcode oligo primer contains the 8-nucleotide sgID sequence and 20-nucleotide degenerate barcode (Supplementary Table S2). The generation of the barcode fragment and subsequent ligation into the vectors were performed as previously described (26).
Lenti-sgRNA/Cre vectors were individually cotransfected into 293T cells with pCMV-VSV-G (Addgene #8454) envelope plasmid and pCMV-dR8.2 dvpr (Addgene #8455) packaging plasmid using polyethylenimine. Supernatants were collected at 48 and 72 hours after transfection, filtered through a 0.45-μm syringe filter unit (Millipore SLHP033RB) to remove cells and debris, concentrated by ultracentrifugation (25,000 × g for 1.5 hours at 4°C), and resuspended in PBS. Each virus was titered against a standard of known titer using LSL-YFP mouse embryonic fibroblasts (MEF; a gift from Dr. Alejandro Sweet-Cordero/UCSF). These MEFs and 293T cells were regularly tested with the MycoAlert Mycoplasma detection kit (Lonza, cat. LT07–418) to make sure that they were free of Mycoplasma. All lentiviral vector aliquots were stored at −80°C and thawed and pooled at equal ratios immediately prior to delivery to mice.
Mice and Tumor Initiation
The use of mice for the current study has been approved by Institutional Animal Care and Use Committee at Stanford University, protocol number 26696.
KrasLSL-G12D/+ (RRID:IMSR_JAX:008179), R26LSL-tdTomato (RRID:IMSR_JAX:007909), and H11LSL-Cas9 (RRID:IMSR_JAX:027632) mice have been previously described (24, 76, 77). They were on a C57BL/6:129 mixed background. The Stag2tm1c(EUCOMM)Wtsi/J (Stag2flox) mice were initially generated by Viny and colleagues (42) and obtained from the Jackson Laboratory (RRID:IMSR_JAX:030902). Tumors were initiated by intratracheal delivery of 60 μL of lentiviral vectors dissolved in PBS.
For the initial experiments, tumors were allowed to develop for 15 weeks after viral delivery of a lentiviral pool that contained 102 barcoded Lenti-sgRNA/Cre vectors (Lenti-sgTS102/Cre). Tumors were initiated in KrasLSL-G12D;R26LSL-Tom/LSL-Tom (KT) mice with 9 × 104 infectious units (ifu)/mouse of the Lenti-sgTS102/Cre pool (12 mice analyzed at 15 weeks after tumor initiation) and in KT;H11LSL-Cas9/LSL-Cas9 mice with 3 × 104 ifu/mouse of the Lenti-sgTS102/Cre pool (47 mice analyzed at 15 weeks after tumor initiation).
After the detection of the top functional tumor suppressors after 15 weeks of tumor development, tumors were initiated in additional mice using a subpool of 85 Lenti-sgRNA/Cre vectors (Lenti-sgTS85/Cre), which excluded the vectors targeting Cdkn2c, Lkb1, Nf1, Trp53, Pten, Rb1, Setd2, and Stag2. Tumors were initiated in KT mice with 2.5 × 105 ifu/mouse (6 mice analyzed at 15 weeks after tumor initiation), KT;H11LSL-Cas9 mice with 6 × 104 ifu/mouse (10 mice analyzed at 15 weeks after tumor initiation), and KT;H11LSL-Cas9 mice with 1.5 × 104 ifu/mouse (40 mice analyzed at 26 weeks after tumor initiation).
For the validation experiments using Lenti-sgRNA/Cre-mediated gene inactivation, tumors were allowed to develop for 15 weeks after viral delivery. Tumors were initiated with individual barcoded Lenti-sgRNA/Cre vectors in KT mice with 1 × 105 ifu/mouse (3 mice per vector analyzed at 15 weeks after tumor initiation) and KT;H11LSL-Cas9 mice with 1 × 105 ifu/mouse (5–6 mice per vector analyzed at 15 weeks after tumor initiation).
For the survival experiments using Lenti-sgRNA/Cre-mediated gene inactivation, tumors were allowed to develop until humane endpoints. Tumors were initiated in KT;H11LSL-Cas9 mice with individual barcoded Lenti-sgInert/Cre vectors at 2 × 104 ifu/mouse and with individual barcoded Lenti-sgStag2/Cre vectors at 1 × 104 ifu/mouse (7 mice per vector analyzed).
For Stag2 validation experiments using the Stag2floxed allele, tumors were initiated with Lenti-sgInert/Cre in KT, KT;Stag2flox/+, KT;Stag2flox/flox, and KT;Stag2flox/y mice with 1 × 105 ifu/mouse (4–5 mice per group analyzed) and allowed to develop for 15 weeks, as well as KT, KT; Stag2flox/+, KT;Stag2flox/flox, and KT;Stag2flox/y mice with 1 × 105 ifu/mouse (6–7 mice per genotype analyzed) and allowed to develop until humane endpoints.
Tuba-seq Library Generation
Genomic DNA was isolated from bulk tumor–bearing lung tissue from each mouse as previously described (26). Briefly, benchmark control cell lines were generated from LSL-YFP MEFs transduced by a barcoded Lenti-sgNT3/Cre vector (NT3: an inert sgRNA with a distinct sgID) and purified by sorting YFP+ cells. For mice initiated with Lenti-sgTS102/Cre pool, 12 benchmark control cell lines (3 cell lines of 500,000 cells each, 3 cell lines of 50,000 cells, 3 cell lines of 5,000 cells, and 3 cell lines of 500 cells) were added to each mouse lung sample prior to lysis to enable the calculation of the absolute number of neoplastic cells in each tumor from the number of sgID-BC reads. Because the standard curve was highly linear, we reduced the benchmark controls to three cell lines with 500,000 cells each for the Lenti-sgTS85/Cre pool. Following homogenization and overnight protease K digestion, genomic DNA was extracted from the lung lysates using standard phenol-chloroform and ethanol precipitation methods.
Subsequently, Q5 High-Fidelity 2× Master Mix (New England Biolabs, M0494X) was used to amplify the sgID-BC region from 32 μg genomic DNA. The unique dual-indexed primers used were forward: AATGATACGGCGACCACCGAGATCTACAC-8 nucleotides for i5 index-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-6 to 9 random nucleotides for increased diversity-GCGCACGTCTGCCGCGCTG and reverse: CAAGCAGAAGACGGCATACGAGAT-6 nucleotides for i7 index-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-9 to 6 random nucleotides for increased diversity-CAGGTTCTTGCGAACCTCAT. The PCR products were purified with Agencourt AMPure XP beads (Beckman Coulter, A63881) using a double-size selection protocol. The concentration and quality of the purified libraries were determined using Agilent High Sensitivity DNA Kit (Agilent Technologies, 5067–4626) on the Agilent 2100 Bioanalyzer (Agilent Technologies, G2939BA). The libraries were pooled based on lung weight to ensure even reading depth, cleaned up again using AMPure XP beads, and sequenced (read length 2 × 150 bp) on the Illumina HiSeq 2500 or NextSeq 550 platform (Admera Health Biopharma Services).
Code and Data Availability
Python 3.6 and R 3.6 were used for analyzing the data. The codes are available on GitHub (https://github.com/lichuan199010/functional-taxonomy-of-tumor-suppressors).
The data sets generated and analyzed in the current study are available in the NCBI Gene Expression Omnibus database (token: ezsjeksixhkvbqh; link: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE146302).
Process Paired-End Reads to Identify the sgID and Barcode
The FASTQ files were parsed to identify the sgID and barcode for each read. Each read is expected to contain an eight-nucleotide sgID region followed by a random nucleotide barcode region (GCNNNNNTANNNNNGCNNNNNTANNNNNGC), and each of the 20 Ns represents random nucleotides. The sgID region identifies the putative tumor suppressor gene being targeted, for which we require a perfect match between the sequence in the forward read and one of the 102 sgIDs with known sequences. Note that all sgID sequences differ from each other by at least three nucleotides. Therefore, the incorrect assignment of sgID due to PCR or sequencing error is extremely unlikely. All cells in a clonal expansion from a cell transduced by a lentiviral vector carry the same barcode. To minimize the effects of sequencing errors on calling the barcode, we require the forward and reverse reads to agree completely within the random nucleotide sequence to be further processed. In our pipeline, any “tumor” within a Hamming distance of 2 from a larger tumor is assigned as a “spurious tumor,” which likely results from sequencing or PCR errors and is removed from subsequent analysis. Reads with the same sgID and barcode are assigned to the same tumor. The tumor size (number of neoplastic cells) is calculated by normalizing the number of reads from an individual tumor to the number of reads from the benchmark control cell lines added to each sample prior to lung lysis and DNA extraction. The minimum sequencing depth was ∼1 read per 43 cells. We have high statistical power in identifying tumors with more than 200 cells, which was used as the minimum cell number cutoff for calling tumors.
Summary Statistics for Overall Growth Rate
Three summary statistics, relative sizes at defined percentiles, relative log-normal mean, and relative tumor burden (will be introduced below), were used to describe the overall tumor growth as previously described. Relative sizes at defined percentiles are nonparametric summary statistics for the tumor size distribution. Specifically, the relative sizes at Xth percentiles are calculated as the Xth percentile [X represents 50% (median), 60%, 70%, 80%, 90%, and 95%] of the tumor size distribution of sgTS tumors divided by the corresponding percentile of the tumor size distribution of all sgInert tumors. This ratio represents the growth advantage at various percentiles conferred by the inactivation of the tumor suppressor gene.
Log-normal mean is the maximum likelihood estimator for the mean number of neoplastic cells for sgTS tumors assuming a log-normal distribution of tumor sizes. Similarly, we calculate the relative log-normal mean by dividing the log-normal mean of sgTS tumors by the log-normal mean of the sgInert tumors (Supplementary Fig. S4).
Summary Statistics for Heavy-Tailedness of the Tumor Size Distribution
Some tumor suppressor genes may lead to rare cases of exceptionally large tumors, which results in a tumor size distribution with a heavy tail. We used two summary statistics, relative Hill estimator and relative steepness, to characterize the heavy-tailedness of the tumor size distribution.
The Hill estimator is a commonly used tail index to characterize the tail shape of heavy-tailed distributions (52). Suppose X1, X2, …, Xn are sgTS tumor sizes, and we order them by size such that X1 ≥ X2 ≥ … ≥Xn. Let Xk be the tumor size at the 95th percentile, and the Hill estimator is calculated as
The relative Hill estimator is calculated by dividing the Hill estimator for tumors with sgTS by that of tumors with sgInert.
The steepness (99th percentile/95th percentile) is calculated as the ratio of the 99th percentile over the 95th percentile for the tumor size distribution for each sgID. Large values of these estimators indicate that the tumor size distributions are heavy-tailed. We calculate the relative steepness by dividing the steepness of tumors with sgTS by that of tumors with sgInert.
For both relative Hill estimator and relative steepness, values higher than 1 indicate that the gene inactivation leads to a heavier tail, and values smaller than 1 indicate gene inactivation leads to a lighter tail than expected (Supplementary Fig. S4).
Summary Statistics for Relative Tumor Number and Relative Tumor Burden
The four metrics above compare the tumor size distribution of sgTS tumors relative to sgInert tumors and can be calculated for both KT;H11LSL-Cas9 mice and KT mice, separately. Unlike these size metrics, relative tumor number and relative tumor burden are affected linearly by lentiviral titer. Therefore, when calculating these two metrics, we normalized it to that in KT mice to account for the viral titer differences among different Lenti-sgRNA/Cre vectors.
We normalized the observed tumor number for sgTS tumors in KT;H11LSL-Cas9 mice by dividing it by that of sgTS tumors in KT mice to account for the titer differences for each sgTS.
The relative tumor number is calculated as the ratio of tumor number for each sgTS relative to sgInert:
The relative tumor number is a metric that reflects the probability of tumor initiation. If the tumor suppressor genes normally constrain tumor initiation, inactivation of the gene will increase the relative tumor number to be larger than 1.
Similarly, we normalized the observed tumor burden for sgTS tumors in KT;H11LSL-Cas9 mice by dividing it by that of sgTS tumors. The relative tumor burden is calculated as the ratio of the tumor burden for each sgTS relative to sgInert:
The relative tumor burden is determined mostly by the largest tumors. For instance, the top 1% of tumor cells accounts for more than 50% of total tumor burden in KT;H11LSL-Cas9 mice at 11 weeks. Both TS inactivation that leads to faster overall growth, rare but exceptionally large tumors, and tumor initiation rate will result in an increase in relative tumor burden (Supplementary Fig. S4).
Bootstrapping the Tumors
In the calculation of confidence intervals and P values, we needed to generate distributions of the statistic considering both variation of tumor sizes across mice and within the same mice. We adopted a two-step bootstrap resampling process. We first bootstrap resampled mice to generate a pseudogroup of mice, and then within each group of resampled mice, we bootstrap resampled all observed tumors carrying each sgID.
Calculation of Confidence Intervals and P Values for Size Metrics
We have four size metrics that describe the overall growth (relative log-normal mean, relative percentiles) and the heavy-tailedness (relative Hill estimator and relative steepness) of the tumor size distribution. For each of these metrics, we bootstrapped tumors 10,000 times and calculated 10,000 values of each statistic for these bootstrap resampling. The 95% confidence interval was calculated as the 2.5th percentile and the 97.5th percentile of these bootstrapped results, whereas the P value was calculated as the proportion of bootstrapped results that are not in the same direction as the observed score compared with the baseline of 1.
Calculation of P Values for Tumor Burden and Tumor Number
We bootstrapped tumors in both the KT;H11LSL-Cas9 and KT mice and calculated the relative tumor burden and relative tumor number from these bootstrapped mice. The process was repeated 106 times. The 95% confidence interval was calculated as the 2.5th percentile and the 97.5th percentile of these bootstrapped results, whereas the P value was calculated as the proportion of bootstrapped values that are not in the same direction as the observed score compared with the baseline of 1.
Robustness to Tumor Burden Differences
To investigate whether overall tumor burden has an impact on genotype-specific tumor initiation and growth, we calculated summary statistics for tumor initiation and tumor size distribution on groups of mice with different overall tumor burden. Specifically, we divided the 47 KT;H11LSL-Cas9 mice with Lenti-sgTS102/Cre-initiated tumors at the 15-week time point into three groups based on the total tumor burden in each mouse, namely, the low tumor burden group (16 mice), the medium tumor burden group (16 mice), and the high tumor burden group (15 mice). We performed calculations separately for each group for four metrics (95th percentile tumor size, log-normal mean, tumor burden, and tumor number) and evaluated whether these metrics show any correlation with tumor burden.
Quantification of Sex Differences
For each statistic, we used the ratio to quantify the differences between female mice and male mice. The ratio was calculated as
where XMale and XFemale are the statistics quantified in male and female mice, respectively. When calculating the P values, we respectively bootstrapped tumors in male and female mice and calculated the proportion of times that the bootstrapped results are not in the same direction as the observed score compared with the baseline of 1.
Empirical Estimation of True-Positive Rates
We estimated the power (true-positive rate) for each of the three experiments: (i) Lenti-sgTS102/Cre, 15-week experiment; (ii) Lenti-sgTS85/Cre, 15-week experiment; and (iii) Lenti-sgTS85/Cre, 26-week experiment. Understanding the true-positive rate is important for understanding the probability of identifying functional tumor suppressor genes. Because we do not have a list for genuine functional tumor suppressor genes, we used each sgRNA that generated a significant tumor suppressor effect (with nominal P < 0.05) as a proxy for true tumor suppressor effects.
For each experiment, whenever we detected a significant effect for an sgRNA, we queried whether the other sgRNA targeting that same gene also generated a significant tumor suppressive effect. If the other sgRNA showed significant tumor suppressor effect, then the test was counted as true (T). If the second sgRNA failed to show a significant tumor suppressor effect, then the test was false (F). Across all sgRNA (including sgRNA#1 and sgRNA#2 for each gene), we tallied the number of true and false discoveries. We used additive smoothing by adding a pseudocount of 0.5 to both T and F counts to avoid the zero-probability problem in some cases. Therefore, the estimated false-negative rate for a gene targeted with a single sgRNA would be
The estimated true-positive rate in our experiment was the probability of failing to identify a functional tumor suppressor gene with both of two sgRNAs. Thus, this is
We performed this calculation separately for four metrics: 95th percentile, log-normal mean, tumor burden, and tumor number. We did not estimate the true-positive rate for the Hill estimator because the number of positive findings was too few for robust estimations.
In Vitro Analysis of sgRNA Efficiency
To analyze the relative cutting efficiencies of the sgRNAs, we measured the insertion and deletion (indel) rates at the target sites in Rosa26LSL-Tomato;H11LSL-Cas9 MEFs that were generated from E12.5 embryos. These MEFs tested negative for Mycoplasma contamination using the MycoAlert Mycoplasma detection kit (Lonza, cat. LT07–418). The 105 MEFs were transduced individually with each Lenti-sgTS/Cre vector and cultured for 1 week followed by FACS-based isolation of Tomato-positive transduced cells. Genomic DNA was extracted from sorted cells using the QIAamp DNA Micro Kit (Qiagen 56304) and subjected to PCR-based target enrichment. Two rounds of PCR were performed with Q5 Master Mix (NEB #M0494L). The first round amplified each of the 97 sgRNA targeted regions (see Supplementary Table S2 for target-enrichment primer sequences). The second round added unique dual-indexed Illumina sequencing adaptors to the amplicons.
These libraries were sequenced on an Illumina NextSeq 500 in the 2 × 150-bp paired-ended configuration (Admera Health Biopharma Services). The resulting reads were demultiplexed based on their sample indexes. CRISPRessoPooled was used to quantify on-target indel mutations (78). Briefly, pooled reads were initially demultiplexed into files according to their specific sgRNA and aligned to the reference sequence to identify indel mutations. Substitution events were ignored, and all indels that occurred within 10 nucleotides of the predicted target site (3 nucleotides upstream from the NGG PAM) were counted as on-target indel mutations. Indel percent mutated was calculated as the number of reads with an on-target indel divided by the total number of reads.
Histology and Immunohistochemistry
Lung lobes were inflated with PBS/4% paraformaldehyde and fixed for 24 hours, stored in 70% ethanol, and paraffin-embedded and sectioned. Then, 4 μmol/L-thick sections were used for hematoxylin and eosin staining and immunohistochemistry (IHC).
Primary antibodies used for IHC were anti-STAG2 (1:500, LifeSpan cat. LS-B11284, RRID:AB_2725802), anti-NKX2.1 (1:250, Abcam cat. ab76013, RRID:AB_1310784), anti-Phospho-RPA2 (1:400, Abcam cat. ab87277, RRID:AB_1952482), anti-Phospho-Histone H2A.X (1:400, Cell Signaling Technology cat. 9718, RRID:AB_2118009), and anti-Phospho-ERK1/2 (1:400, Cell Signaling Technology cat. 4370, RRID:AB_2315112). IHC was performed using the Avidin/Biotin Blocking Kit (Vector Laboratories, SP-2001), Avidin-Biotin Complex Kit (Vector Laboratories, PK-4001), and DAB Peroxidase Substrate Kit (Vector Laboratories, SK-4100) following the standard protocols. Human lung adenocarcinoma tissue microarrays were purchased from US Biomax (HLugA120PG01, BC041115e, LC1261, LC706a, NSC155, and NSC157).
Whole-Genome Sequencing and Quantitative RT-PCR
For whole-genome sequencing and qRT-PCR–based gene expression analysis, samples were generated from Lenti-Cre–initiated tumors from three KT and three KT;Stag2flox/flox mice (a subset of samples from Fig. 3G). Briefly, neoplastic cells were isolated from pooled tumors within two lung lobes of each mouse by FACS for Tomatopositive lineage (CD45/CD31/F4–80/Ter119)negative cells (79). In total, 60,000 to 100,000 neoplastic cells were collected from each mouse. Genomic DNA and total RNA were purified using the Qiagen AllPrep DNA/RNA Micro Kit (cat. 80284). Genomic DNA was processed with Nextera Flex for karyotyping by low-pass (0.1× coverage) whole-genome sequencing. Log2 ratio of reads mapping to each genomic locus compared with the average number of reads mapping to all other comparable loci was plotted.
For qRT-PCR, total RNA was reverse-transcribed using the Reliance Select cDNA Synthesis Kit with oligo(dT) primers (BioRad cat. 12012802). Quantitative PCR was performed with PowerUp SYBR Green Master Mix (Thermo Fisher Scientific cat. A25776) on an Applied Biosystems QuantStudio 3 Real-Time PCR System. PCR primers were as follows:
Fos: 5′-TACTACCATTCCCCAGCCGA-3′ and 5′-GCTGTCACCGTGGGGATAAA-3′
Klf2: 5′-GAGCCTATCTTGCCGTCCTT-3′ and 5′-TTGTTTAGGTCCTCATCCGTG-3′
Ifnl3: 5′-GTGCAGTTCCCACCTCATCT-3′ and 5′-TGGGAGTGAATGTGGCTCAG-3′
Ifnb1: 5′-GTCCTCAACTGCTCTCCACT-3′ and 5′-CATCCAG GCGTAGCTGTTGTA-3′
Mx1: 5′-ACGGTGCAGACATACCAGAA-3′ and 5′-CTGTCTCCCTCTGATACGGT-3′
Ifi44: 5′-ATGGCAGCAAGAAAAGTGCC-3′ and 5′-AAACTTCTGCACACTCGCCT-3′
Irf1: 5′-CCAGAGATTGACAGCCCTCG-3′ and 5′-TGCACAAGGAATGGCCTGAA-3′
Gapdh: 5′-TGTGAACGGATTTGGCCGTA-3′ and 5′-ACTGTGCCGTTGAATTTGCC-3′
Actb: 5′-GGCTCCTAGCACCATGAAGA-3′ and 5′-GTGTAAA ACGCAGCTCAGTAACA-3′
Power Analyses
Power analyses were used to evaluate the ability of the Tuba-seq platform to identify functional tumor suppressors across a variety of experimental scenarios. The likelihood of detecting a tumor suppressor depends on the strength of its effect, the number of mice assayed, and the number of guides in the viral pool. We explored how these parameters influence statistical power to detect genes affecting tumor growth and initiation through a pair of nonparametric nested resampling approaches.
For each simulation that focused on tumor growth, a pseudo-cohort of mice (n = 5, 10, 20, 50, 100, 200) was sampled with replacement from the cohort of 47 KT;H11LSL-Cas9 mice analyzed 15 weeks after tumor initiation, and statistical significance was assessed by bootstrap resampling of tumors from the pseudo-cohort. For a given viral titer, a larger number of multiplexed vectors result in fewer tumors with each sgRNA and a resulting loss of power due to less thorough sampling of the underlying distribution of tumor sizes. To model this effect, the number of tumors sampled from each mouse was scaled by the ratio of the number of sgIDs in the underlying data to the simulated number of sgIDs (n = 10, 20, 50, 100, 200, 500). To capture differences in power due to effect size, we performed analyses for representative strong, moderate, and weak tumor suppressor-targeting sgRNAs (sgNf1#1, sgRb1#1, and sgDot1l#1, respectively). Five hundred simulations were performed for each gene, with a minimum of 16,000 bootstrap samplings per simulation. In each bootstrap, the size of tumor at the 95th percentile with the focal genotype was compared with the size of tumor with sgInerts at the 95th percentile, and significance in each simulation was assessed by bootstrapped P value <0.05 (two-tailed test, Bonferroni corrected for the simulated number of pooled sgRNAs).
Effects on tumor initiation are inferred through changes in the representation of tumor genotypes in KT;H11LSL-Cas9 mice relative to the original proportions of the sgRNAs in the lentiviral vector pool. As a result, identifying genes that influence tumor initiation requires comparison of KT;H11LSL-Cas9 mice to KT mice, in which the relative abundance of genotypes reflects the makeup of the viral pool. For each simulation, we therefore sampled a cohort of both KT;H11LSL-Cas9 and KT mice (n = 5, 10, 20, 50, 100, 200). For simplicity, we maintained the approximate 4:1 ratio of KT;H11LSL-Cas9:KT used in this study while ensuring that there was more than 1 KT mouse per cohort (e.g., for 50 total mice, we sampled 40 KT;H11LSL-Cas9 and 10 KT mice). Analogous to the tumor size simulations, we modeled the effect of the number of pooled sgRNAs by scaling the number of tumors sampled from each mouse by the ratio of the number of sgIDs in the underlying data to the simulated number of sgIDs (n = 10, 20, 50, 100, 200, 500); the resulting data set was then bootstrapped to assess significance. To capture differences in power due to effect size, analyses were performed for representative strong, moderate, and weak suppressors of tumor initiation (sgPten#2, sgKdm6a#2, and sgNcoa6#1, respectively). Five hundred simulations were performed for each gene, with a minimum of 16,000 bootstrap samplings per simulation. In each bootstrap, the relative tumor number (ratio of number of tumors with focal genotype to number of sgInert tumors) in KT;H11LSL-Cas9 mice was compared with the relative tumor number in KT mice, and significance in each simulation was assessed by bootstrapped P value <0.05 (two-tailed test, Bonferroni corrected for the simulated number of pooled sgRNAs).
DepMap Data and Filtering
Cancer cell line dependency data (DepMap Public 19Q4) and mutation data (Cancer Cell Line Encyclopedia) were acquired from the Broad Institute DepMap Portal (RRID:SCR_017655) (59). Lung adenocarcinoma cell lines were identified by their Project Achilles identification code. For each gene of interest, the cell lines that contained damaging mutations within the gene were identified and flagged. Damaging mutations were defined as mutations that likely caused loss of gene function. Subsequently, dependency scores for each gene of interest were exported from both the complete data set of lung adenocarcinoma cell lines and data set of cell lines that contains no damaging mutation in the gene of interest. Finally, the distribution of dependency scores across each gene of interest was plotted using GraphPad Prism 8.
Authors' Disclosures
H. Cai reports grants from the University of California during the conduct of the study. S.K. Chew reports grants from Ono Pharmaceuticals outside the submitted work. S.C. Lee reports other support from Agency for Science, Technology and Research (A*STAR) outside the submitted work. M. Yousefi reports grants from the NIH, American Lung Association, and Stanford Dean's Fellowship during the conduct of the study. D.A. Petrov reports personal fees from D2G Oncology outside the submitted work; in addition, D.A. Petrov has patents (10738300 and 10801021) issued to D2G Oncology and patents pending (20190367908 and 20180282720) to D2G Oncology. C. Swanton reports grants and personal fees from Pfizer, Bristol Myers Squibb, Ono Pharmaceuticals, and Roche-Ventana; grants from Boehringer Ingelheim and Archer Dx Inc. (collaboration in minimal residual disease sequencing technologies); personal fees from Novartis, GlaxoSmithKline, MSD, Celgene, Illumina, Amgen, Genentech, GRAIL, Bicycle Therapeutics, Medixci, Sarah Canon Research Institute, Achilles Therapeutics, and AstraZeneca; stock options from GRAIL, Epic Biosciences, Apogen Biotechnologies, and Achilles Therapeutics; also, C. Swanton is an advisory board member and chief investigator for the MeRmaiD1 clinical trial from AstraZeneca and is cofounder of Achilles Therapeutics outside the submitted work; in addition, C. Swanton has a patent for assay technology to detect tumor recurrence (PCT/GB2017/053289), a patent for targeting neoantigens (PCT/EP2016/059401), a patent for response to immune checkpoint blockade (PCT/EP2016/071471), a patent for determining whether HLA LOH is lost in a tumor (PCT/GB2018/052004), a patent for predicting survival rates of cancer patients (PCT/GB2020/050221), a patent for treating cancer by targeting insertion/deletion mutations (PCT/GB2018/051893), a patent for identifying insertion/deletion mutation targets (PCT/GB2018/051892), a patent for detecting tumor mutations (PCT/US2017/028013), and a patent for identifying responders to cancer treatment (PCT/GB2018/051912). M.M. Winslow reports grants from the NIH during the conduct of the study, has filed patents broadly related to this work, and is a founder and adviser of D2G Oncology, Inc. No disclosures were reported by the other authors.
Authors' Contributions
H. Cai: Conceptualization, validation, investigation, visualization, writing–original draft. S.K. Chew: Conceptualization, formal analysis, investigation, visualization, methodology, writing–original draft. C. Li: Data curation, formal analysis, validation, investigation, visualization, methodology, writing–original draft. M.K. Tsai: Investigation. L. Andrejka: Investigation. C.W. Murray: Investigation, writing–review and editing. N.W. Hughes: Formal analysis. E.G. Shuldiner: Formal analysis, visualization. E.L. Ashkin: Investigation. R. Tang: Resources. K.L. Hung: Validation, investigation. L.C. Chen: Formal analysis, investigation. S.C. Lee: Formal analysis. M. Yousefi: Investigation. W. Lin: Investigation. C.A. Kunder: Formal analysis. L. Cong: Supervision. C.D. McFarland: Formal analysis, methodology. D.A. Petrov: Conceptualization, resources, supervision, funding acquisition, project administration, writing–review and editing. C. Swanton: Conceptualization, resources, supervision, funding acquisition, writing–review and editing. M.M. Winslow: Conceptualization, resources, supervision, funding acquisition, investigation, methodology, project administration, writing–review and editing.
Acknowledgments
We thank the Stanford Shared FACS Facility for flow cytometry and cell sorting services, the Stanford Veterinary Animal Care Staff for expert animal care, Human Pathology/Histology Service Center, Stanford Protein and Nucleic Acid Facility, the Francis Crick Genomics Equipment Park, Advanced Sequencing Facility, Bioinformatics & Biostatistics, and Y. Zhao, D. Maghini, and R. Ma for experimental support; A. Orantes for administrative support; R. Levine's laboratory for making the Stag2flox allele available prior to publication; and D. Feldser, J. Sage, and members of the Winslow, Petrov, and Swanton laboratories for helpful comments. H. Cai was supported by a Tobacco-Related Disease Research Program (TRDRP) Postdoctoral Fellowship (28FT-0019). S.K. Chew was supported by the European Research Council (ERC) under the European Union's Seventh Framework Programme (FP7/2007–2013) Consolidator Grant (THESEUS). C. Li is the Connie and Bob Lurie Fellow of the Damon Runyon Cancer Research Foundation (DRG-2331). C.W. Murray was supported by the NSF Graduate Research Fellowship Program and an Anne T. and Robert M. Bass Stanford Graduate Fellowship. N.W. Hughes was supported by the NSF Graduate Research Fellowship Program. R. Tang was supported by a Stanford University School of Medicine Dean's Postdoctoral Fellowship and a TRDRP Postdoctoral fellowship (27FT-0044). M. Yousefi was supported by a Stanford University School of Medicine Dean's fellowship, an American Lung Association senior research training grant, and NIH Ruth L. Kirschstein National Research Service Award (F32-CA236311). C.D. McFarland was supported by NIH K99-CA226506. W.-Y. Lin was supported by an American Association for Cancer Research Postdoctoral fellowship (17–40–18-LIN). C. Swanton is Royal Society Napier Research Professor (RP150154). This work was supported by the Francis Crick Institute, which receives its core funding from Cancer Research UK (FC001169), the UK Medical Research Council (FC001169), and the Wellcome Trust (FC001169). This research was funded in whole, or in part, by the Wellcome Trust (FC001169). For the purpose of Open Access, the author has applied a CC BY public copyright license to any Author Accepted Manuscript version arising from this submission. C. Swanton is funded by Cancer Research UK (TRACERx, PEACE, and CRUK Cancer Immunotherapy Catalyst Network), Cancer Research UK Lung Cancer Centre of Excellence, the Rosetrees Trust, Butterfield and Stoneygate Trusts, NovoNordisk Foundation (ID16584), Royal Society Professorship Enhancement Award (RP/EA/180007), the National Institute for Health Research (NIHR) Biomedical Research Centre at University College London Hospitals, the CRUK-UCL Centre, Experimental Cancer Medicine Centre, and the Breast Cancer Research Foundation (BCRF). This research is supported by a Stand Up To Cancer–LUNGevity–American Lung Association Lung Cancer Interception Dream Team Translational Research Grant (Grant Number: SU2C-AACR-DT23–17). Stand Up To Cancer (SU2C) is a program of the Entertainment Industry Foundation. Research grants are administered by the American Association for Cancer Research, the Scientific Partner of SU2C. C. Swanton receives funding from the European Research Council (ERC) under the European Union's Seventh Framework Programme (FP7/2007–2013) Consolidator Grant (FP7-THESEUS-617844), European Commission ITN (FP7-PloidyNet 607722), an ERC Advanced Grant (PROTEUS) from the European Research Council under the European Union's Horizon 2020 research and innovation program (grant agreement No. 835297), and Chromavision from the European Union's Horizon 2020 research and innovation program (grant agreement 665233). This work was supported by NIH R01-CA207133 (to M.M. Winslow and D.A. Petrov), NIH R01-CA231253 (to M.M. Winslow and D.A. Petrov), NIH R01-CA234349 (to M.M. Winslow and D.A. Petrov), and in part by the Stanford Cancer Institute support grant (NIH P30-CA124435).
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.